Development of real time PCR assay for detection and

Development of real time PCR assay for detection and quantification of teliospores of Tilletia indica in soil Malkhan Singh Gurjar1*, ... Further, the...

0 downloads 21 Views 244KB Size
Indian Journal of Experimental Biology Vol. 55, June 2017, pp. 549-554

Development of real time PCR assay for detection and quantification of teliospores of Tilletia indica in soil Malkhan Singh Gurjar1*, Rashmi Aggarwal1, Abhimanyu Jogawat1, Sapna Sharma1, Deepika Kulshreshtha1, Anuja Gupta2, Robin Gogoi1, Thirumalaisamy PP3 & Abhinav Saini1 1

Division of Plant Pathology, ICAR-Indian Agricultural Research Institute (IARI), Pusa campus, New Delhi, India 2 ICAR- Indian Agricultural Research Institute (IARI), Regional station, Karnal, Haryana, India 3 ICAR-Directorate of Groundnut Research, Junagarh, Gujarat, India Received 21 October 2016; revised 13 January 2017

Tilletia indica, commonly called Karnal bunt, is an internationally quarantined wheat fungal pathogen which affects commercial seed trading as well as the quality of wheat grain for consumption. The teliospores of Tilletia indica surviving in soil serve as the primary source of inoculum and play a major role in disease development. Proper identification and detection of T. indica teliospores based on morphological features and germination of teliospores is time consuming and tedious. In this study, we validated PCR based species-specific primer which amplified 570 bp fragments using ITSKB primers. Further, the real time PCR assay was developed and standardized for detection and quantification of teliospores in soil. The (R2) correlation coefficient (0.994) between CT values and DNA concentrations showed the accuracy of qPCR based quantification. The sensitivity of qPCR marker was 100 fg. Thirteen field soil samples were assessed by qPCR for quantification of teliospore DNA. Low fungal DNA (15135.61 fg) was detected in field soil (K10) from Karnal, Haryana, India while high DNA concentration (3.31 ng) was detected in field soil from IARI, New Delhi (K4). The qPCR assay was done to correlate DNA concentration and number of teliospores per gram soil. The 125.89 fg DNA concentration of T. indica detected corresponding limit of 14 teliospores. Minimum detection limit in terms of teliospores count was 14. The teliospores recovered from Karnal and IARI farm soils by centrifugation method were 450 and 1341, respectively while the qPCR assay based analysis detected higher number of teliospores ranging 1762 to 368332 teliospores. Thus, the developed qPCR diagnostic marker could be used for accurate, reliable and rapid detection of teliospores in soil which would further help in monitoring, quantifying teliosporic load and threshold level of inoculum in soil. Keywords: Karnal bunt, Real time PCR, Teliospores, Triticum, Wheat

Karnal bunt (Tilletia indica Mitra. Syn. Neovossia indica (Mitra) Mundkur.) of wheat is a serious fungal disease, first reported from Karnal, India in 19311, reported for its frequent occurrence in northwestern India2, has now observed to have grown out of proportion and acquired quarantine importance with the present climate change scenario3. In India, the disease has been recorded in the states of Punjab, Haryana, Jammu, lower Himachal Pradesh, Uttar Pradesh, Delhi, Rajasthan and Bihar4. Most of the parts of Madhya Pradesh, southern Rajasthan, Maharashtra and Peninsular India are free from Karnal bunt due to high prevailing temperature during crop season5. Occurrence of the disease is erratic in eastern India and seldom exceeds traces to very low levels of infection6. Karnal bunt disease has significance not only due to qualitative and quantitative losses but it poses a _________ *Correspondence: Phone: +91 9999103422 (Mob.) E-mail: [email protected]

barrier in commercial seed trading at national and international markets. Resistance breeding is being used for management of Karnal bunt disease by identifying QTLs, however resistant varieties is difficult because of climatic conditions and limited KB resistance7. It is also called partial bunt as a part of wheat seed in some florets in spike is replaced by black powder consisting millions of teliospores8,9. The disease occurs in those areas where average temperature during the crop season varies between 5 and 25°C and relative humidity is 45-100 %. The soil borne teliospores serve as the primary source of inoculum for causing infection. Teliospores can survive in the soil for at least five years or in/on stored seed for longer periods10,11. When there is a cool and moist condition, teliospores on or near the soil surface germinate to produce numerous spores called primary sporidia/or basidiospores12. These primary sporidia give rise to secondary sporidia by budding, which continuously multiply on leaf surfaces13 and infect between the boot leaf and soft

550

INDIAN J EXP BIOL, AUGUST 2017

dough stage14. At the time of maturity, these teliospores are liberated during harvest/threshing to the soil surface and the disease cycle begins again. Since soil borne inoculum is the primary source for recurrence of the disease annually, detection and quantification of teliospores in soil is essential. Earlier, to quantify soil borne teliospores, various methods has been used15,16. These methods used to quantify T. indica teliospores in soil are tedious, error prone and low recovery percentage. Further, it can detect and quantify (>1000) teliospores from soil. Therefore, there is a need to develop molecular methods for detection and quantification of Tilletia indica in soil even at low level of inoculums. Moreover, it is important to differentiate T. indica from other closely related species. The inability to distinguish two closely related Tilletia species17 morphologically, has encouraged researchers to look for PCR based methods18 that distinguished T. indica and T. walkeri. When teliospores are young and dormant often they do not germinate19. The detection and quantification of T. indica spores have always been a cumbersome and inaccurate in soil. Also, morphological identification of spores is not always reliable and accurate20. DNA based detection techniques are more rapid, specific and highly sensitive especially for seed borne pathognes21. In real-time PCR, SYBR green based detection do not require probe which can reduce assay setup and running costs, assuming that primers are well designed. In this context, here, we attempted to develop and validate a rapid, accurate and reliable real time PCR marker for detection and quantification of soil borne teliospores. Materials and Methods Collection and maintenance of T. indica, other fungal isolates and field soil samples

Karnal bunt wheat samples were collected from different locations of Uttar Pradesh, Haryana, Rajasthan and Delhi states in India. Karnal bunt infected grains brought to the fungal and molecular biology laboratory, Division of Plant Pathology, IARI, New Delhi. After that, the samples were surface sterilized with 70 % ethanol. Teliospores of 10 (KB1KB10) isolates were harvested on butter paper under aseptic conditions and stored for further use. Other fungal species viz. Tilletia caries, Ustilago tritici (Indian Type Culture Collection, IARI, New Delhi), Alternaria alternata (Indian Type Culture Collection, IARI, New Delhi), Bipolaris sorokiniana (BS-75),

Puccinia triticina (race 77-5) and Pucinia striiformis f.sp. tritici (race 78S89) were maintained which is used as negative controls. Thirteen natural soil samples were collected from different fields of IARI farm, New Delhi and IARI, Regional Station, Karnal, Haryana in the year of 2015 (rabi season). DNA extraction from teliospores of T. indica

The teliosporic suspension of T. indica isolates (KB1-KB10) was prepared (in sterilized MQ water). DNA was extracted using ZR soil Microbe DNA Mini Prep kit (Zymo Research). In brief, about 50 mg teliospores were collected from infected seed and added to lysis tube and mixed with lysis solution. The mixture was agitated vigorously vortexed for 5 min at maximum speed for 30 min. The tube containing disrupted spores was centrifuged and the supernatant was collected and filtered. Further, the teliosporic DNA was bound to the binding column, washed twice and finally eluted by adding 50 µL of elution buffer followed by centrifugation at 10000 ×g for 2 min. Teliosporic genomic DNA was quantified using NanoDrop 2000c UV-VIS Spectrophotometer (Thermo Scientific, USA) and kept at −40°C for further use. Confirmation of species specific marker

ITSKB marker developed earlier in our laboratory22 and was revalidated for its specificity, taking ten isolates of Tilletia indica (KB1-KB10) and six other fungal isolates viz. Ustilago tritici (ITCC), Tilletia caries, Alternaria alternata (ITCC), Bipolaris sorokiniana (BS-75), Puccinia triticina (77-5) and Pucinia striiformis tritici (78S89). PCR amplifications were carried out in 25 µL reaction volume consisting of 100 ng of genomic DNA, 200 µmol/L dNTP mix (dATP, dGTP, dCTP, dTTP), 0.1 µmol/L each primers, 3.5 mmol/L MgCl2, 1.5 U Taq DNA polymerase, 9.5 µL water and 1X Taq buffer in a thermal cycler (Bio-Rad Laboratories India Pvt. Ltd. India). The process of amplification was as follows: one cycle of denaturation at 94°C for 5 min, followed by 35 cycles of denaturation at 94°C for 1 min, annealing at 47°C for 1 min and extension at 72°C for 2 min and a final extension step at 72°C for 10 min. The PCR product was separated on 1.2 % agarose gel stained with ethidium bromide (0.5 µg/L) in TAE buffer (pH 8.0) along with the 100 bp DNA ladder (MBI, Fermentas). The electrophoresis was carried out in TAE buffer at constant voltage (75 V) for 1.5 h visualized under UV trans-illuminator and photographed in gel documentation system (Gel Doc XR+, Bio-Rad).

GURJAR et al.: RT-PCR ASSAY FOR DETECTION AND QUANTIFICATION OF TILLETIA INDICA TELIOSPORES

Designing of specific primers for real time PCR analysis

The real time PCR based forward and reverse nested primers were developed from ITS region (GenBank AY560652) of Tilletia Indica (Table 1). Primers were designed in IDT Oligo Analyzer and in silico analysis for primer specificity was conducted by running the primer sequence against the nonredundant GenBank data with parameters set for identification of short, nearly exact matches and specificity. Optimization and development of standard curve for qPCR assay

Firstly, standard dilutions with known concentration of T. indica teliospores were added to soil (1 mg of teliospore/1g of soil) containing 2×105 teliospores. Then, DNA was extracted using ZR soil Microbe DNA Mini Prep kit (Zymo Research) as described in DNA extraction protocol. The DNA of T. indica diluted 10 folds of by serial dilutions (in sterile MQ water). The qPCR conditions viz. annealing temperature, primer concentration and temperature to measure the fluorescence signal of specific amplicon using T. indica DNA as template were optimized in Mini Opticon Real Time PCR system (Biorad, USA). Two replications per sample were kept in all experiments. The standard curve was developed by plotting the CT (threshold cycles) values depicting by the crossing cycle number versus the log10 of the quantity of the serially diluted genomic DNA. Linear regression analyses of the logarithm10 of known concentrations of target DNA verses CT values were performed. The standard regression line was used as reference curve for transforming the experimental CT values into concentration of DNA (fg). Validation of developed qPCR marker for detection of Tilletia indica in soil

The one gram of soil was subjected to DNA isolation (Zymo Research) followed by quantitative PCR assay. The quantification was done by calculating the CT values against the standard curve. A qPCR assay was also performed for counted teliospores in soil to obtain the corresponding concentration of DNA. Six soil suspensions were prepared by diluting the soil to get 7, 14, 28, 42 and 56 numbers of Table 1—Details of Tilletia indica species specific primers Primers Primer sequence Amplicon Reference size (bp) 'ITSKB F ITSKB R KBMS F KBMS R

5'ACGGAGCTCTTCTTCGGA 3' 5' TCGATGATTCCGAAGAAT 3' 5'GATTGCTTGGAGTTGGTGATG 3' 5'CCTCTATACAGAATCCGGTTGTG 3'

570 bp

22

150 bp

This study

551

teliospores in 5, 10, 20, 30 and 40 µL water. The DNA quantification was analyzed by calculating the CT value against the standard curve. Enumeration of teliospores using Sucrose centrifugation method

Thirteen natural soil samples were used for teliospore recovery by sucrose centrifugation method23. Each 1g soil was suspended in 200 mL of tap water. This soil suspension was passed through a 100 µm metal sieve and then through a 50 µm Spectra/Mesh nylon filter and the filtrate was collected. The remaining debris on both sieves was washed using a fine sprinkler, and the filtrate was collected. This suspension (approximately 2 L) was then passed through a 20 µm Spectra/Mesh nylon filter. The materials caught on the 20 µm mesh were washed into two 50 mL centrifuge tubes and spun for 3 min (1200 × g) using centrifuge with some modifications. Further, the water suspension was pipetted onto haemocytometer for enumeration of teliospores. Results Confirmation of ITSKB marker for detection of Tilletia indica

The species specific marker (ITSKB) was revalidated in fungal genomic DNA of T. indica along with checks of other six fungal genera/species. The 570 bp band was amplified specifically in T. indica isolates (KB1-KB10) only and it did not amplify in Ustilago tritici, Tilletia caries, Alternaria alternata (ITCC), Bipolaris sorokiniana (BS-75), Puccinia triticina (race 77-5), Puccinia striiformis f. sp. tritici (race 78S84) (Fig. 1). This result confirmed that this marker was species specific and precise in detection of T. indica. Further, based on this marker, real time PCR marker was developed. Designing of qPCR primers and development of standard curve for qPCR

Forward and reverse nested PCR primers were designed for qPCR assay. The qPCR conditions were optimized as follows: 95°C for 10 min and 40 cycles

Fig. 1—PCR amplification of Tilletia indica (KB1-KB10) with ITSKB primer. [M, 100 bp DNA ladder; lanes 1-10, Tilletia indica; lane 11, Ustilago tritici; lane 12, T. caries; lane 13, Alternaria alternata; lane 14, Bipolaris sorokiniana (BS-75); lane 15, Puccinia triticina (race 77-5); and lane 16, Puccinia striiformis tritici (race 78S84)]

552

INDIAN J EXP BIOL, AUGUST 2017

of PCR amplification at 95°C for 15 s and 64°C for 30 s followed by default melt curve analysis. The optimized qPCR mixture consisted of total reaction volume of 20 µL that contained 1 µL total DNA (ng), 10 µL of SYBR mix (Thermo Scientific), 0.2 µM of each primer and sterile distilled water to reach the volume. The standard curve was drawn using input T. indica DNA in sterilized distilled MQ water and in soil DNA showed a linear correlation between CT (threshold cycle) values and DNA concentration (fg), with a correlation coefficient (R2) of 0.992 showing the accuracy of real time quantification of PCR. First fluorescent signals were observed at CT 21.40 corresponding highest DNA concentration 1 ng and CT 30.51 corresponding approximately to 100 fg DNA (Fig. 2). Amplification was confirmed by melting curve showing one distinct peak at 78°C, which indicated the specificity of the quantitative PCR (Fig. 3). Target DNA showed fluorescence while no fluorescence signals occurred in negative controls. The sensitivity of the qPCR was 100 fg using real time primers (KBMS).

Fig. 2—Standard curve. X-axis showing log10 DNA amount (fg) plotted against the real time PCR cycle threshold (Ct) on Y-axis for different dilutions of genomic DNA

Validation of qPCR marker

This qPCR marker (KBMS) was further validated to know the teliosporic load in 13 field soils which was collected from IARI farm and IARI, Regional Station, Karnal, India. The qPCR assayed that the field soil (K10, Karnal) was found to be low level of 15135.61 fg (0.01513561 ng) of DNA concentration while the high DNA concentration (3.31 ng) was detected in soil (K4, IARI, New Delhi) of T. indica (Fig. 4). Another, a qPCR was performed to check the sensitivity of spores in the field soil. The fluorescence showed at Ct 30.10 in sample two containing minimum 14 teliospores corresponding approximately to 125 fg DNA concentration (Table 2). The fluorescence observed in sample one containing 7 spores was insignificant due to higher Ct value (34.2). This qPCR marker can detect 14 teliospores in soil with approximately 125 fg DNA concentration. Comparative analysis of teliospores centrifugation method and qPCR assay

detection

using

About 900 to 1341 teliospores per gram of soils were recovered in (K1-K4) using sucrose centrifugation method but qPCR assay detected high number of teliospores ranging from 44283 to 368332 in soils of New Delhi (Table 3). Teliospores recovery was 483-716 in karnal soils (K5-K13), whereas qPCR assay revealed 1762-29939 teliospores in karnal field soils of Karnal

Fig. 3—Melting curve of qPCR products obtained with Tilletia indica specific primers. [Single peak shows that there were no unspecific amplifications. Also no peaks were observed in negative control]

Fig. 4—Validation of qPCR marker showing Ct values and DNA concentration in field soils, K1-K4: IARI farm, New Delhi and K5-K13: Karnal Table 2—The qPCR assay comprising of teliospores, Ct value and DNA Conc. (fg) Sample Soil suspension No. of Mean Ct DNA (µL) spores value Conc. (fg) 1 5 7 34.2 65 2 10 14 30.10 125.89 3 20 28 28.49 660.2 4 30 42 27.79 2511 5 40 56 26.40 7413 Note: [Out of 5 dilutions, minimum 14 spores were detected giving CT value 30.1, beyond this first dilution gave 34.2 Ct value for which fluorescence signal were insignificant]

GURJAR et al.: RT-PCR ASSAY FOR DETECTION AND QUANTIFICATION OF TILLETIA INDICA TELIOSPORES

Table 3— Comparative analysis of teliospores detection using sucrose centrifugation method and qPCR assay Field Mean teliospores DNA Conc. Teliospores soil sample recovered/g of soil (fg) detected detected by using conventional by qPCR qPCR technique IARI farm MB 900.00 398107.17 44283 3C (K1) IARI farm MB 750.00 380189.39 42290 9A (K2) IARI farm 4A 883.33 389045.15 43275 (K3) IARI farm 12 A 1341.67 3311311.21 368332 (K4) Karnal (K5) 550.00 147910.83 16452 Karnal (K6) 583.33 165958.69 18460 Karnal (K7) 716.67 269153.48 29939 Karnal (K8) 483.33 15848.93 1762 Karnal (K9) 500.00 81283.05 9041 Karnal (K10) 450.00 15135.61 1683 Karnal K11) 583.33 165958.69 18460 Karnal (K12) 483.33 15850.93 1763 Karnal (K13) 533.33 85113.80 9467

Discussion Karnal bunt of wheat is a quarantine disease and occurs sporadically influenced by weather conditions. It affects export and import of wheat trade internationally. The teliospores of T. indica in the seed get into the soil at the time of harvesting and threshing. The teliospores serve as source of inoculum and survive up to 5 years in soil24. Highest germination occurs with one year-old teliospores19. The detection based on teliospores size and morphology under microscopy are less reliable, time consuming, tedious because of the contamination with other morphologically similar smut and bunt spores, which are non quarantine pathogens. The size of the teliospores cannot be taken as a criterion for differentiating physiological races of T. indica25. The visual examination and selective sieve-wash tests for detection and quantification of teliospores are time consuming26. In present study, the ITSKB marker was reconfirmed in teliosporic DNA of T. indica. The 570 bp fragment was amplified in T. indica isolates only and it did not amplify in control fungal species. It shows specificity in Tilletia indica only. The ITS (Internal Transcribed Spacer) sequences are species specific and invariable within species or may show little variation. These sequences have been used widely for species-specific detection among various fungal cultures. Using real time PCR, it was possible to detect the presence of pathogen even quantification of amount present in sample become evident to give

553

quantitative assessment of number of pathogen in given sample27. The limitations with conventional PCR are that only final concentration of the amplicon can be analyzed using DNA binding dyes after stopping reaction at different intervals and standard curves are generated which is tough and slow process. Therefore, use of real time PCR technique with fluorescent probes or fluorescent dyes makes the detection and quantification possible in a single step. In the present investigation, BLAST analysis showed that designed species specific qPCR primer sequences (KBMS) did not have similarity in any other fungal species/genera. Therefore, we attempted to develop quick, reliable and more sensitive methods to detect pathogen in soil. A qPCR assay was standardized; amplification was confirmed by melting curve showing one distinct peak at 78°C, which indicated the specificity of the qPCR marker. T. indica DNA showed fluorescence while no fluorescence signals occurred in negative checks. The sensitivity of this qPCR marker (KBMS) was 100fg. Thirteen soil samples were analyzed and validated of marker using real time PCR. It revealed that the low (15135.61fg) DNA concentration found in field soil (K10, Karnal) while high of DNA concentration (3.31ng) of T. indica detected soil (K4, New Delhi). The developed qPCR marker (KBMS) can be able to detect 14 teliospores in soil with corresponding 125 fg of DNA concentration. Earlier in our laboratory, conventional PCR detection was limited to 500 teliospores corresponding 60 ng of DNA from wheat karnal bunt infected seed19. In our study, comparatively analysis of teliospores detection using sucrose centrifugation method and qPCR assay. Teliospores recovery was low ranges from 450 to1341 using sucrose centrifugation method in all soils (K1-K13) while qPCR assay detected high population of teliospores ranging from 1762 to 368332. Conventional methods like sieving and sucrose centrifugation method for detection of pathogen from soil are less sensitive, tedious and time consuming15. Filter and centrifuge extraction technique could detect and quantify (>1000) teliospores into soil samples28. Recently a LAMP assay was developed for detection of T. indica but sensitivity was 10 pg of fungal DNA29. In conclusion, the sensitivity of qPCR was increased up to 100 fg DNA and 14 teliospores in soil. High level of inoculum in the soil is positively correlated with severe disease incidence in Gurdaspur of Punjab30

INDIAN J EXP BIOL, AUGUST 2017

554

using conventional methods. Further, there is need to investigate threshold level of teliospores to cause karnal bunt disease of wheat. Possibly, this is first real time PCR based marker to detect and quantify teliospores of Tilletia indica and demonstrated in field soils. Further, it may help in quantifying teliosporic load and threshold level of inoculum in soil of wheat growing areas. Acknowledgement We gratefully acknowledge the research grant from ICAR-Consortium Research Platform on Genomics (IARI-12:151/2015) for funding of this research work. References 1 2 3

4

5 6

7

8

9

10

11

12

13

Mitra M, A new bunt on wheat in India. Ann Appl Biol, 18 (1931) 178. Gill KS, Sharma I & Aujla SS, Karnal and wheat production, Punjab Agriculture University. Ludhiana. (1993) 153. Gurjar MS, Jogawat A, Kulshresta D, Sharma S, Gogoi R & Aggarwal R, Intraspecific variation of Tilletia indica isolates causing Karnal bunt of Wheat in India. Indian Phytopathol, 69 (2016) 352. Joshi LM, Singh DV, Srivastava KD & Wilcoxson RD, Karnal bunt, a minor disease that is now a threat to wheat. Bot Rev, 49 (1983) 309. Sharma AK, Kumar J & Nagarajan S, Disease management strategy in wheat. Indian Farm, 18 (1998) 52. Singh DV, Srivastava KD, Aggrawal R & Jain SK, Factors associated with development and spread of Karnal bunt of wheat (Triticum aestivum) in North West India. Indian J Agr Sci, 66 (1989) 374. Kaur M, Singh R, Kumar S, Mandhan RP & Sharma I, Identification of QTL conferring Karnal bunt resistance in bread wheat. Indian J Biotechnol, 15 (2016) 34. Fuentes-Davila G, Karnal bunt. In ‘Bunt and Smut diseases of wheat: concepts and methods of disease management’. (Eds. RD Wilcoxson and EE Saari; CIMMYT: Mexico, DF), 1996, 26. Aggarwal R, Singh DV & Srivastava KD, Host pathogen interaction in Karnal bunt of wheat. Indian Phytopathol, 47 (1994) 381. Agarwal VK & Verma HS, A simple technique for the detection of karnal bunt infection in wheat seed samples. Seed Res, 11 (1983) 100. Bonde MR, Nester SE, Olsen MW & Berner DK, Survival of teliospores of Tilletia indica in Arizona field soils. Plant Dis, 88 (2004) 804. Nagarajan S, Ajula S, Nanda G, Sharma I, Goel L, Kumar J & Singh D, Karnal bunt (Tilletia indica) of wheat—a review. Rev Plant Pathol, 76 (1997) 1207. Dhaliwal HS, Multiplication of secondary sporidia of Tilletia indica on soil, wheat leaves and spikes and incidence of Karnal bunt. Can J Bot, 67 (1989) 2387.

14 Krishna A & Singh R, Investigations on the disease cycle of Karnal bunt of wheat. Indian J Mycol Plant Pathol, 12 (1982) 124. 15 Singh DV, Siddiqui KA, Aggarwal R, Srivastava KD, Maurya AK & Arora P, Extraction of teliospores of Neovossia indica from soil mixed with the teliospores. Indian Phytopathol, 43 (1990) 500. 16 Castro DA, Schadd NW & Bonde MR, A technique for extracting Tilletia indica teliospores from contaminated wheat seeds. Seed Sci Technol, 22 (1994) 91. 17 Pimentel G, Carris L, Levy L & Meyer R, Genetic variability among isolates of Tilletia barclayana, T. indica and allied species based on RAPD and PCR-RFLP analysis. Mycology, 90 (1998) 1017. 18 Frederick R, Snyder K, Tooley P, Berthier-Schaad Y, Peterson G, Bonde M, Schaad N, & Knorr D, Identification and differentiation of Tilletia indica and T. walkeri using the polymerase chain reaction. Phytopathology, 90 (2000) 951. 19 Levy L, Castlebury L, Carris L, Meyer R & Pimentel G, Internal transcribed spacer sequence-based phylogeny and polymerase chain reaction-restriction fragment length polymorphism differentiation of Tilletia walkeri and T. indica. Phytopathology, 91 (2001) 935. 20 Bansal R, Singh DV & Joshi LM, Germination of teliospores of Karnal bunt of wheat. Seed Res, 11 (1983) 258. 21 Majumder D, Rajesh T, Suting EG & Debbarma A, Detection of seed borne pathogens in wheat: recent trends. Aust J Crop Sci, 7(2013) 500. 22 Thirumalaisamy PP, Singh DV, Aggrawal R, Gogoi R, Gupta PK & Singh PK, Development of species-specific primers for detection of Karnal bunt pathogen of wheat. Indian Phytopathol, 64 (2011) 164. 23 Babadoost M & Mathre DE, A method for extraction and enumeration of teliospores of Tilletia indica, T. controversa, and T. barclayana in soil. Plant Dis, 82 (1998) 1357. 24 Singh DV & Gogoi R, Karnal bunt of wheat (Triticum sp.): A global scenario. Indian J Agr Sci, 81 (2011) 3. 25 Bansal R, Singh DV & Joshi LM, Comparative morphological studies in teliospores of Neovossia indica. Indian Phytopathol, 37 (1984) 355. 26 Tan MK, Brennan JP, Wright D & Murray GM, An enhanced protocol for the quarantine detection of Tilletia indica and economic comparison with current standard. Australas Plant Pathol, 39 (2010) 334. 27 Kashyap PL, Kaur S, Sanghera GS, Kang SS & Pannu PPS, Novel methods for quarantine detection of Karnal bunt (Tilletia indica) of wheat. Elixir Agric, 31 (2011) 1873. 28 Tan MK, Raman M, Chambers G, Sharma I, Chen Z, Deshpande N & Wilkins MR, Characterization of SNP and structural variations in the mitochondrial genomes of Tilletia indica and its closely related species formed basis for a simple diagnostic assay PLos One, (2016) DOI:10.13714. 29 Babadoost M, Mathre DE, Johnston RH & Bonde MR, Survival of teliospores of Tilletia indica in soil. Plant Dis, 88 (2004) 56. 30 Singh DV & Srivastava KD, Investigations on Karnal bunt (Neovossia indica) of wheat. Final Technical Report of PL480 Project, IARI, New Delhi, 1992.