Water and sustainability Multiple Choice Test December, 5th 2017
Carefully read the “EXAMINATION RULES” and “EXAM INSTRUCTIONS”
EXAMINATION RULES 1. You are NOT allowed to bring any personal items into the examination room, except for the water bottle, personal medicine or approved personal medical equipment. 2. You must sit at your designated desk. 3. Check the stationery items (pen, calculator, and scrap paper) provided by the organizers. 4. Do NOT start answering the questions before the “START” signal. 5. You are NOT allowed to leave the examination room during the examination except in an emergency in which case you will be accompanied by a supervisor/volunteer/invigilator. 6. If you need to visit the bathroom, please raise your hand. 7. Do NOT disturb other competitors. If you need any assistance, raise your hand and wait for a supervisor to come. 8. Do NOT discuss the examination questions. You must stay at your desk until the end of the examination time, even if you have finished the exam. 9. At the end of the examination time you will hear the “STOP” signal. Do NOT write anything more on the answer sheet after this stop signal. Arrange the exam, answer sheets, and the stationary items (pen, calculator, and scrap paper) neatly on your desk. Do NOT leave the room before all the answer sheets have been collected.
14th IJSO 2017, Nijmegen, The Netherlands ‒ Multiple Choice Test ‒ Dec. 5th 2017
page 2 of 19
EXAM INSTRUCTIONS 1. After the “START” signal, you will have 3 hours to complete the exam. 2. ONLY use the pen and pencil provided by the organizers. 3. Check that your name, code and country are on your answer sheet and sign your answer sheet. Raise your hand, if you do not have the answer sheet. 4. Read each problem carefully and indicate your answer on the answer sheet using a cross (as shown below). There is only one correct answer for each question. Example: (A) is your answer.
5. If you want to change your answer, circle your first answer and then indicate your new answer using a cross (as shown below). You can only make ONE correction per question. Example: (A) is your first answer and (D) is your final answer.
6. Only the answer sheet will be evaluated. Before writing your answers on the answer sheet, use the scrap paper provided. 7. Point rules Correct answer Wrong answer No answer
: + 1 point : − 0.25 point : no point
8. The total number of questions is 30. Check that you have a complete set of the test questions (15 pages, page 5 – page 19) after the “START” signal is given. Raise your hand, if you find any missing sheets. 9. Useful information for answering the questions (atomic masses, constants and formulas) is provided on page 4.
14th IJSO 2017, Nijmegen, The Netherlands ‒ Multiple Choice Test ‒ Dec. 5th 2017
page 3 of 19
GENERAL INFORMATION The first twenty elements of the Periodic System with their standard atomic weights H 1.008 Li 6.941 Na 22.99 K 39.10
He 4.003 Be B C N O F Ne 9.012 10.81 12.01 14.01 16.00 19.00 20.18 Mg Al Si P S Cl Ar 24.31 26.98 28.09 30.97 32.06 35.45 39.95 Ca 40.08
Constants acceleration due to gravity:
g = 9.81 m/s2
gas constant
R = 8.3145 J/(mol K)
Formulas area of a circle:
A = πr2
circumference of a circle:
C = 2πr
volume:
V = Ah
density:
ρ=
pressure:
p=
heat:
Q = mcΔT
power:
P=
gravitational potential energy:
Ep = mgh
Ohm’s law:
V = IR
𝑚 𝑉 𝐹 𝐴 𝐸 𝑡
14th IJSO 2017, Nijmegen, The Netherlands ‒ Multiple Choice Test ‒ Dec. 5th 2017
page 4 of 19
Biology questions – Corrected version Rate of flow of blood In a muscle in the upper arm of a human, blood runs through arteries, capillary vessels and veins. The picture shows the total area of a cross section of one of these arteries (a), the subsequent capillary vessels (c) and the corresponding returning veins (v). X = direction of the blood flow Y = total area of cross section
flow direction
flow direction
rate of flow
rate of flow
rate of flow
rate of flow
1. Which of the following pictures correctly shows the rate of flow (velocity) of the blood through an artery, a capillary vessel and a vein concerned?
flow direction
flow direction
Fermentation and Respiratory Quotient RQ Floris investigates the conversion of glucose by yeast. The glucose is converted anaerobically as well as aerobically. Consider the reaction equations: Aerobic: Anaerobic:
C6H12O6 + 6 O2 → 6 CO2 + 6 H2O C6H12O6 → 2 C2H5OH + 2 CO2
Floris starts off with a solution containing 0.50 mol of glucose and some yeast. By measuring the loss of mass he is able to determine the amount of CO2 generated. When all the glucose is converted, the total loss in mass due to the generation of CO2 is 79.2 g (= 1.8 mol CO2). Floris assumes that no carbon dioxide remains in the solution. Now Floris is able to calculate the Respiratory Quotient of the process. The Respiratory Quotient is defined as: moles of CO2 (produced) 𝑅𝑄 = moles of O2 (used) 2. What is the correct Respiratory Quotient? A B C D
RQ RQ RQ RQ
= 0.67 = 1.2 = 1.5 = 1.8
14th IJSO 2017, Nijmegen, The Netherlands ‒ Multiple Choice Test ‒ Dec. 5th 2017
page 5 of 19
Glucose concentration in blood The picture shows blood circulation in a mammal. Four locations are indicated by A, B, C and D. 3. Which location has the lowest glucose concentration?
Sphagnum The distribution of Sphagnum (moss) species is influenced by pH, but not by other abiotic factors. After a long period of stable weather conditions Tom investigates the distribution of three different Sphagnum species on a small island surrounded by brackish water. The results are shown below. moss distribution pH distribution
= Sphagnum squarrosum = Sphagnum fimbriatum = Sphagnum recurvum
Three conclusions are: I II III
Sphagnum squarrosum can only survive if pH > 4.0. Competition occurs between Sphagnum recurvum and Sphagnum fimbriatum. Sphagnum recurvum and Sphagnum squarrosum have overlapping habitats.
4. Which conclusion(s) are correct? A B C D
only II only I and III only II and III I, II and III
14th IJSO 2017, Nijmegen, The Netherlands ‒ Multiple Choice Test ‒ Dec. 5th 2017
page 6 of 19
Hay water Mary boiled water and dried grass in a beaker for some time, and left it uncovered for several days. During that period only heterotrophic bacteria were found in the beaker. After ten days, she added a few drops of water from a ditch and covered it with a lid. The water from the ditch only contained heterotrophic unicellular organisms, but no bacteria or fungi. Mary regularly determined the population size of the different species present in the beaker over three months. Alltogether six different species (p - u) were found. The diagram shows the number of individuals per mL in the beaker.
X = Time (days); Y = number of individuals per mL Looking at the results Mary considers two conclusions. I II
Eventually the number of dividing bacteria will decrease to zero. Eventually a climax stage will develop, comprising bacteria and other heterotrophic unicellular organisms, in a stable natural equilibrium.
5. Which conclusion(s) is/are correct? A B C D
only I only II both I and II neither I nor II
14th IJSO 2017, Nijmegen, The Netherlands ‒ Multiple Choice Test ‒ Dec. 5th 2017
page 7 of 19
Identification of Caminalcules In modern biology DNA plays an important role in distinguishing different species. In the past this was done primarily by considering external characteristics. The picture below shows Caminalcules: non-existent creatures invented by Joseph Camin to demonstrate to his students how to distinguish species and set up evolutionary trees.
The eight Caminalcules shown can be distinguised with just three of the following four features: Long arms, long body, presence of belly spots, and presence of fingers. 6. Which of the following four features is NOT needed? A B C D
long arms long body presence of belly spots presence of fingers
14th IJSO 2017, Nijmegen, The Netherlands ‒ Multiple Choice Test ‒ Dec. 5th 2017
page 8 of 19
Water loss In a pilot study the daily water loss of a group of subjects is monitored under different conditions. Three processes are monitored: diffusion (not sweating) of water through skin, lung ventilation, and urine production. The table shows the results in a random order. Average daily loss of water in mL/day mild exercise at 20 °C
mild exercise at 30 °C
strenuous exercise at 20 °C
Process I
350
250
650
Process II
50
50
50
Process III
1400
1300
600
7. Which processes correspond to lung ventilation and urine production?
A B C D
lung ventilation
urine production
process process process process
process process process process
I I II III
II III III I
Temperature-sensitive alleles Some fly species have alleles that are temperature sensitive. Fertilized eggs only develop below a specific temperature, see the table below. Genotype
Temperature necessary for development
EE
< 18 °C
Ee
< 20 °C
ee
< 28 °C
Two flies, both with genotype Ee, mate. Their fertilized eggs (F1) are allowed to develop at 19 °C. The F1 flies mate randomly and the eggs produced are again allowed to develop at 19 °C. 8. What fraction of eggs produced in the F1 crossing will not develop? A B C D
1/9 2/9 4/9 6/9
14th IJSO 2017, Nijmegen, The Netherlands ‒ Multiple Choice Test ‒ Dec. 5th 2017
page 9 of 19
DNA and evolutionary relation Several people (A - E) in the same city contract Legionnaires’ disease. It is important to identify how many sources are causing this outbreak, and what those sources are, to prevent the disease from spreading. The pathogens’ DNA is extracted, and the alleles of seven of its genes are determined to identify the number of sources. Then, for each pair of patients, we count how often the alleles for those seven genes are different, known as the ‘distance’ between the patient’s pathogens. If the two pathogens of two patients are identical on all seven genes, then the distance is 0, whereas if the pathogens have different alleles for all seven genes, the distance is 7. The distances for all pairs of patients A - E are given below in the ‘Distance matrix’.
Patient B
Patient C
Patient D
Patient E
Patient A
Distance matrix
5
5
1
4
Patient A
2
5
2
Patient B
6
1
Patient C
6
Patient D Patient E
The data in the table can be used to depict the relation of the pathogens in patients A - E as a dendrogram (tree structure). 9. Which of the dendrograms below corresponds to the distance matrix?
II
I A B C D
III
IV
I II III IV
14th IJSO 2017, Nijmegen, The Netherlands ‒ Multiple Choice Test ‒ Dec. 5th 2017
page 10 of 19
Legionella Strains of Legionella (the bacterium responsible for Legionnaires’ disease) can be identified by means of the allele for the gene flaA. This gene codes for a protein that is part of the bacterium’s flagellum. The bases 670 to 700 of the coding strand (the complement of the template strand) of the DNA of an allele of Legionella’s flaA gene are represented below. Bases 197 to 199 make up the start codon. 670-----------------------------------------------------------------------700 5’
TTTCAGTATCGGCAGCACAAAAGCTTCTTCT
3’
10. What is the correct order of the amino acids in the part of the protein that is coded for by the DNA fragment above? Use the table below, in which the genetic code is depicted. standard genetic code 1st
2nd base
base
U
C
3rd A
base
G
(5’-end) U
C
A
G
A B C D
(3’-end) UUU Phe (F) UCU
Ser (S)
UAU
Tyr (Y)
UGU Cys (C)
U
UGC
C
UUC
UCC
UAC
UUA Leu (L)
UCA
UAA
Stop
UGA
UUG
UCG
UAG
Stop
UGG Trp (W)
G
CUU
CCU
CAU
His (H)
CGU
U
CUC
CCC
CAC
CGC
C
CUA
CCA
CAA
Gln (Q) CGA
A
CUG
CCG
CAG
CGG
G
AAU
Asn (N) AGU AGC
AUU
Ile (I)
ACU
Pro (P)
Thr (T)
AUC
ACC
AAC
AUA
ACA
AAA
AUG Met (M) ACG
AAG
GUU Val (V)
GCU
GUC
Ala (A)
Lys (K)
AGA
Stop
Arg (R)
Ser (S)
A
U C
Arg (R)
AGG
A G
GAU Asp (D) GGU Gly (G)
U
GCC
GAC
GGC
C
GUA
GCA
GAA
GGA
A
GUG
GCG
GAG
GGG
G
Glu (E)
Phe - Ser - Ile - Gly - Ser - Thr - Lys - Ala - Ser - Ser Phe - Gln - Tyr - Trp - Gln - His - Lys - Ser - Phe - Phe Ser - Val - Ser - Ala - Ala - Gln - Lys - Leu - Leu Lys - Ser - Stop
14th IJSO 2017, Nijmegen, The Netherlands ‒ Multiple Choice Test ‒ Dec. 5th 2017
page 11 of 19
Chemistry questions Photosynthesis by algae Surface water can contain organic and inorganic matter. In many surface water most of the organic matter is formed by photosynthesis. Phytoplankton, such as algae, are one of the major producers of organic matter. In this organic matter carbon atoms, nitrogen atoms and phosphorous atoms often occur in the following ratio: C : N : P = 106 : 16 : 1. Organic matter produced during photosynthesis by algae can be described by the formula C106H263O110N16P. The following incomplete equation summarizes phytoplankton photosynthesis: _ NO3— + _ HPO42— + _ H+ + … → C106H263O110N16P + …
(equation 1)
In this equation some coefficients are missing as well as the formulas of some molecules. 11. Which molecules are missing in this incomplete equation? A B C D
on the left
on the right
CO2 CO2 and H2O CO2 and O2 O2
H2O and O2 O2 H2O CO2 and H2O
12. What should the coefficient of H+ be when equation 1 is balanced? A B C D
3 16 17 18
Green chemistry Green chemistry is an area of chemistry and chemical engineering that deals with the development of sustainable production processes. Two important concepts in green chemistry are atom economy and the E ‒ factor. The formulas for these concepts are:
atom economy =
mass of the desired product × 100% mass of the starting materials
and
𝐸 − factor =
mass of the starting materials − mass of the obtained product mass of the obtained product
13. Which words have to be filled in for I and for II in the sentence below? A green process has a ..I.. atom economy and a ..II.. E ‒ factor. A B C D
I
II
high high low low
high low high low
14th IJSO 2017, Nijmegen, The Netherlands ‒ Multiple Choice Test ‒ Dec. 5th 2017
page 12 of 19
Determination of oxygen Dissolved oxygen (O2) is important for underwater life. The concentration of oxygen in polluted surface water can decrease dangerously. Therefore this concentration is determined regularly. The concentration of dissolved oxygen can be determined with a titration. A sample of 10.00 mL is taken from the surface water. The sample is treated with an acidic solution of potassium iodide after which the following reaction takes place: O2 + 4 H+ + 4 I— → 2 I2 + 2 H2O An excess of an acidic solution of potassium iodide is added to make sure that all oxygen reacts. Next the iodine is titrated with a 0.0100 M solution of sodium thiosulfate (Na2S2O3). The following reaction takes place: I2 + 2 S2O32— → 2 I— + S4O62— Starch is used to indicate the endpoint of the titration. A student performed the determination. At the end of the titration the solution turned colorless when the last drop of the solution of sodium thiosulfate was added, as it should. Nevertheless it turned out that the calculated concentration of dissolved oxygen higher than expected. 14. Which of the following errors could be responsible for this result? I II A B C D
After rinsing the burette with distilled water the burette was immediately filled with the solution of sodium thiosulfate. At the start of the titration the nozzle through which the titrant should leave the burette was filled with air, not with the solution of sodium thiosulfate. only I only II both I and II neither I nor II
The numerical value of the concentration of dissolved oxygen in mg per liter is given by the relation К × Vthio . In which Vthio is the volume, in mL, of the sodium thiosulfate solution that was used in the titration. 15. What is the value of К? A B C D
4.00 8.00 16.0 32.0
14th IJSO 2017, Nijmegen, The Netherlands ‒ Multiple Choice Test ‒ Dec. 5th 2017
page 13 of 19
Fertilizer from urine In some open air rock festivals in The Netherlands, the urine that those attending produce is collected. This urine is first treated in such a way that the urea in it is converted into ammonium salts. Then the pH of the solution is adjusted and a solution of magnesium chloride is added, to give an insoluble compound called struvite. The formula of struvite is MgNH4PO4.6H2O. In this way phosphate is recovered, which contributes to slowing the depletion of natural sources of phosphorous. Also a useful fertilizer is obtained. The pH of the solution is important, as both phosphate and ammonium are involved in pH dependent equilibria. In Figure 1 the percentage occurrence of H3PO4, H2PO4—, HPO42— and PO43— as a function of pH is given. In Figure 2 the percentage occurrence of NH4+ and NH3 as a function of pH is given.
Figure 1
Figure 2
The reaction wherein struvite is formed, is carried out at a pH of about 8. The reaction equation shows the main species that are present in the solution. 16. Which equation describes the formation of struvite at pH = 8? A B C D
Mg2+ Mg2+ Mg2+ Mg2+
+ + + +
NH3 + 7 H2O + PO43— → MgNH4PO4.6H2O + OH— NH4+ + PO43— + 6 H2O → MgNH4PO4.6H2O NH3 + HPO42— + 6 H2O → MgNH4PO4.6H2O NH4+ + HPO42— + 5 H2O + OH— → MgNH4PO4.6H2O
Hydrogen fuel cell Hydrogen is regarded as a fuel of the future, because there is no emission of CO2. Hydrogen can be used in fuel cells. 17. Which reaction takes place at which electrode in a hydrogen powered fuel cell during use? positive electrode A B C D
H2 H2 O2 O2
+
→ 2H + 2 e— + 4 H+ + 4 H+
—
+2e → 2 H+ + 4 e— → 2 H2O → 2 H2O + 4 e—
negative electrode O2 O2 H2 H2
+ 4 H+ + 4 e— → 2 H2O + 4 H+ → 2 H2O + 4 e— → 2 H+ + 2 e— + 2 e— → 2 H+
14th IJSO 2017, Nijmegen, The Netherlands ‒ Multiple Choice Test ‒ Dec. 5th 2017
page 14 of 19
Elimination of CO2 Carbon dioxide is a greenhouse gas. During the combustion of fossil fuels, large amounts of carbon dioxide are formed. To prevent this from entering the atmosphere, one might consider to remove it using the so called water-gas shift reaction. In this reaction carbon dioxide reacts with hydrogen to form carbon monoxide and water: CO2(g) + H2(g)
CO(g) + H2O(g)
The enthalpy of formation of CO2, CO, and H2O are as follows: CO2(g): ‒ 394 kJ/mol, CO(g): ‒ 111 kJ/mol and H2O(g): ‒ 242 kJ/mol. 18. What is the reaction enthalpy (ΔrH) of the forward reaction; is this reaction endothermic or exothermic? A B C D
Δr H
endothermic/exothermic
‒ 41 kJ/mol ‒ 41 kJ/mol + 41 kJ/mol + 41 kJ/mol
endothermic exothermic endothermic exothermic
Using the water-gas shift reaction to prevent carbon dioxide from entering the atmosphere has the drawback that the highly toxic gas carbon monoxide is formed. Carbon monoxide can be converted into methanol by adding extra hydrogen gas. The formation of methanol from carbon monoxide and hydrogen is an equilibrium reaction: CO(g) + 2 H2(g)
CH3OH(g)
The forward reaction is exothermic. 19. Which of the following conditions favors the formation of methanol in this equilibrium reaction? I II
high pressure high temperature
A B C D
only I only II both I and II neither I nor II
Fertilizers The quality of surface water in the Netherlands is influenced by the use of fertilizers in agriculture. Many fertilizers contain nitrogen (N). It is important to reduce the use of nitrogen in fertilizer to minimize the nitrogen load of surface water. Three nitrogen containing fertilizers are: (NH4)2SO4 (ammonium sulfate), CaCN2 (calcium cyanamide), and CO(NH2)2 (urea). 20. Which of these fertilizers has the highest mass percentage of nitrogen? A B C D
ammonium sulfate calcium cyanamide urea all three have the same mass percentage of nitrogen
14th IJSO 2017, Nijmegen, The Netherlands ‒ Multiple Choice Test ‒ Dec. 5th 2017
page 15 of 19
Physics questions Solar shower You can use solar power to have a warm shower while camping. The Solar Camp Shower bag (see Figure 1), contains 15 kg of water with a temperature of 18 C. On a sunny day, the water absorbs 200 W of solar power. 21. How long does it take for the water to reach a temperature of 35 °C? (The specific heat of water is c = 4.2x103 J/(kg K).) A B C D
0.4 0.8 1.5 3.0
h h h h
Liquid and vapor
Figure 1: Solar Camp Shower.
Boiling transforms 1 liter of liquid into 1000 liters of vapor at a certain pressure. Consider the following statements. I II
The density of the vapor is 1/1000th times the density of the liquid. The average distance between the molecules in the vapor phase is 10 times the average distance between the molecules in the liquid phase.
22. Which of these statements is true? A B C D
only I only II both I and II neither I nor II
Hydro pneumatic suspension The hydro pneumatic suspension of some cars is equipped with spring bulbs. Such a metal bulb is filled with nitrogen gas. The purpose of the gas is to lift about ¼ of the weight of the car that rests on the suspensions, via a piston, oil and a rubber membrane (see Figure 2). The area of the rubber membrane is 200 cm2. The weight of the car that rests on the suspensions is 16 000 N. Neglect the weight of the oil and the piston. The whole system is in rest. The pressure of the outer air is 1.0·105 Pa. 23. What is the pressure of the enclosed nitrogen gas? A B C D
2.0·105 Pa 3.0·105 Pa 8.0·105 Pa 12·105 Pa
14th IJSO 2017, Nijmegen, The Netherlands ‒ Multiple Choice Test ‒ Dec. 5th 2017
Figure 2: Spring bulb. 1 = ¼ weight of the car 2 = piston 3 = oil 4 = rubber membrane 5 = nitrogen gas
page 16 of 19
Heating paraffin A constant amount of heat is added per second to a certain amount of solid paraffin (see Figure 3).
thermometer
paraffin water
Figure 4: T - t diagram
Figure 3: Experimental setup
The graph in Figure 4 displays the temperature (T) of the paraffin as a function of time (t). Consider the following two statements regarding the change in the temperature of the paraffin. I II
The specific heat capacity of liquid paraffin is smaller than that of solid paraffin. During melting, the potential energy of the molecules increases.
24. Which of these statement(s) is true? A B C D
only I only II both I and II neither I nor II
A little boat and a bottle in a river On a windless day, someone throws an empty sealed bottle in the river Waal, and the bottle floats downstream. At the same time, and at the same place, a powerboat sails upstream. After 10 minutes, the boat turns quickly around and travels downstream with the same power as before. After a while, the boat overtakes the bottle. At that time, the bottle and the boat are 3 km downstream from the initial starting point. 25. How fast does the river Waal flow on a windless day? A B C D
3 km/h 9 km/h 12 km/h 15 km/h
14th IJSO 2017, Nijmegen, The Netherlands ‒ Multiple Choice Test ‒ Dec. 5th 2017
page 17 of 19
Electric circuit In the circuit depicted in Figure 5, slide S is displaced along variable resistor R towards point X. 26. How does the current passing resistors P and Q change? A B C D
in P
in Q
increases increases decreases decreases
increases decreases increases decreases
Figure 5: Electric circuit
Supertanker A supertanker sails from the North Sea, via a river, to the port of Rotterdam. 27. Which statement about the draft (i.e. how deep a ship lies in the water) is true when the ship sails from the sea into the river? A B C D
The tanker will have a deeper draft in the river. The tanker will have a shallower draft in the river. The draft will remain the same. The draft depends on the air pressure.
Figure 6: Supertanker
Electricity storage In California, storage systems will be installed to improve regulation of the production of electricity by wind turbines. When there is an energy surplus, the wind turbine drives a flywheel. The cylindrical flywheel has a diameter of 0.90 m, a length of 1.5 m and a mass of 1 350 kg. The maximum frequency of the flywheel is 20 000 revolutions per minute. When the storage system has to supply electricity, the flywheel drives the generator. The 1 rotational energy of a spinning object equals Erot = Iω2, with the moment of inertia 2 1 2 I = mR for a cylinder with mass m and radius R that turns with angular velocity ω (in 2 rad/s). 28. Taking these data into account, how much energy can maximally be stored by the flywheel? A B C D
7.6·106 1.5·108 3.0·108 1.2·109
J J J J
14th IJSO 2017, Nijmegen, The Netherlands ‒ Multiple Choice Test ‒ Dec. 5th 2017
page 18 of 19
Sky crane A sky crane was used for the landing of the Mars explorer ‘Curiosity’. The four exhausts expel combustion gases that hold the crane at a constant height before landing. The four exhausts are arranged in an oblique arrangement. In Figure 7 you can see the thrust exerted on the crane by the gas from exhaust A. The thrust of the gas ejected from the other exhausts have the same magnitude and operate at the same angle. Compare the thrust (Fthrust) at A to the gravitational force (Fg) on the whole system. 29. Which statement is true? A B C D
Fthrust Fthrust Fthrust Fthrust
= = < >
Fg ¼Fg ¼Fg ¼Fg
Figure 7: The landing system A = One of the four exhausts B = Mars explorer ‘Curiosity’ C = Flying crane
Properties of water Two specific properties of water are highlighted below. Property 1 The heat capacity of water is large compared to other common substances. Property 2 The density of water behaves differently between 0 C and 4 C compared to other substances (see Figure 8). Consider the following statements: I II
Figure 8: Y = density of water in kg/dm3 X = temperature in C
Property 1 has a stabilizing effect on the average temperature on earth. Property 2 causes that liquid water with a temperature of + 4 °C will be located on the bottom of a ditch, when there is a thin layer of ice on top of the water.
30. Which of these statements is true? A B C D
only I only II both I and II neither I nor II
14th IJSO 2017, Nijmegen, The Netherlands ‒ Multiple Choice Test ‒ Dec. 5th 2017
page 19 of 19
