Quantitative Real-Time PCR Assay for Detection of

It has been reported that P. polymyxa strains produce numerous secondary metabolites including auxins, cytokinins, lytic enzymes, and antimicrobial co...

0 downloads 2 Views 2MB Size
J. Microbiol. Biotechnol. (2012), 22(11), 1575–1579 http://dx.doi.org/10.4014/jmb.1207.07018 First published online September 7, 2012 pISSN 1017-7825 eISSN 1738-8872

Quantitative Real-Time PCR Assay for Detection of Paenibacillus polymyxa Using Membrane-Fusion Protein-Based Primers Cho, Min Seok1*, Dong Suk Park2, Jung Won Lee1, Hee Youn Chi1, Soo-In Sohn2, Bong-Kyun Jeon1, and Jong-Beom Ma1 1

Smarteome Co., Ltd., Suwon 441-853, Korea National Academy of Agricultural Science, Rural Development Administration, Suwon 441-707, Korea

2

Received: July 13, 2012 / Revised: August 14, 2012 / Accepted: August 15, 2012

Paenibacillus polymyxa is known to be a plant-growthpromoting rhizobacterium. The present study describes a quantitative polymerase chain reaction (qPCR) assay for the specific detection and quantitation of P. polymyxa using a primer pair based on the sequence of a membranefusion protein for the amplification of a 268 bp DNA fragment. This study reports that the qPCR-based method is applicable for the rapid and sensitive detection of P. polymyxa and can be used as an alternative method for agricultural soil monitoring. Keywords: Detection, membrane-fusion protein, Paenibacillus polymyxa, quantitation

Paenibacillus polymyxa, a nonpathogenic and endosporeforming Bacillus, is one of the most industrially significant facultative anaerobic bacterium because of its great biotechnological potential in different industrial processes and in sustainable agriculture. It inhabits different niches such as soils, roots, and the rhizosphere of various crop plants including wheat, maize, sorghum, sugarcane, barley, forest trees, and marine sediments [7]. It has been reported that P. polymyxa strains produce numerous secondary metabolites including auxins, cytokinins, lytic enzymes, and antimicrobial compounds that are useful for biotechnological applications [2, 4-6, 10-12]. Consequently, many researchers have conducted studies to find ways to exploit its useful functions in agricultural systems, specifically in plant growth promotion and biological control against plant pathogens. However, there are few reports on the specific detection and quantitation of rhizobia [3, 8]. Recently, molecular assays based on the 16S rRNA gene have been used for the detection of P. polymyxa [12], but there have been critical defects in the *Corresponding author Phone: +82-2-6465-1023; Fax: +82-31-278-5351; E-mail: [email protected]

identification of P. polymyxa isolates, as these assays also detect other Paenibacillus spp., such as Bacillus spp., because the 16S rRNA gene is highly conserved in genomes at the species or genus levels. Membrane-fusion proteins are found in all living organisms. It is known that many types of membranefusion proteins involved in energy production, lipid biosynthesis, protein secretion, and transport are conserved in the bacterial cell [9]. Membrane-fusion proteins of functional subunits of multicomponent transporters perform diverse physiological functions in both Gram-positive and Gram-negative bacteria [14]. Therefore, we have developed a marker gene system based on a membrane-fusion protein that allows simpler detection of P. polymyxa in an environmental sample, including soil and plants. We used bioinformatics analysis to search the available P. polymyxa E681 genome database in the National Center for Biotechnology Information (NCBI). Furthermore, we tested in silico by performing a similarity sequence alignment search of the membrane-fusion protein gene of P. polymyxa E681 (GenBank Accession No. ADM71678.1, gi:305859890, gb|CP000154.1:4232316-4233653) using BLAST and e-PCR analysis. The results showed some significant matches with previously determined sequences (BLASTN ver. 2.2.25+), and the BLASTN searches showed similarity to the multidrug ABC transporter permease sequences [identity = 88%, score = 1580 bits (855), and expect = 0.0] from P. terrae HPL-003. BLAST searches with the predicted protein sequence (BLASTX) revealed similarity to the unnamed protein product sequence [identity = 93%, score = 756 bits (1952), and expect = 0.0] from P. terrae HPL-003 and hypothetical protein sequence [identity = 87%, score = 721 bits (1860), and expect = 0.0] from Paenibacillus spp. Aloe-11. However, the region to be amplified with the designed primer pair revealed no significant match in both BLASTN and BLASTX searches.

1576

Cho et al.

Table 1. Bacterial strains used in the PCR specificity test. No. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47

Bacterial namea Paenibacillus polymyxa Paenibacillus polymyxa Paenibacillus polymyxa Paenibacillus polymyxa Paenibacillus polymyxa Paenibacillus azotofixans T Paenibacillus anaericanus T Paenibacillus assamensis T Paenibacillus barcinonensis T Paenibacillus brasilensis T Paenibacillus castaneae T Paenibacillus chibensis T Paenibacillus chinjuensis T Paenibacillus favisporus T Paenibacillus forsythiae T Paenibacillus gansuensis T Paenibacillus ginsengarvi T Paenibacillus lactis T Paenibacillus larvae Paenibacillus massiliensis T Paenibacillus motobuensis T Paenibacillus naphthalenovorans T Paenibacillus odorifer T Paenibacillus panacisoli T Paenibacillus pasadenensis T Paenibacillus phyllosphaerae T Paenibacillus pini T Paenibacillus pinihumi T Paenibacillus rhizosphaerae T Paenibacillus soli T Paenibacillus tarimensis T Paenibacillus terrae T Paenibacillus thiaminolyticus T Paenibacillus timonensis T Paenibacillus tundrae T Paenibacillus wynnii T Paenibacillus xinjiangensis T Paenibacillus xylanexedens T Paenibacillus xylanilyticus T Rhizobium cellulosilyticum T Rhizobium daejeonense T Rhizobium rhizogenes T Rhizobium rubi T Rhizobium vitis T Pseudomonas aeruginosa T Pseudomonas fluorescens T Escherichia coli T

Collection No. KACC 10098 KACC 10790 LMG 6322 LMG 6023 LMG 13295 LMG 14658 KACC 11533 KACC 12301 KACC 11450 KACC 13842 KACC 14162 KACC 11526 KACC 12279 KACC 15577 KACC 14518 KACC 12291 KACC 13906 KACC 11525 KACC 14031 KACC 11490 KACC 11488 KACC 11505 KACC 11494 KACC 13041 KACC 14475 KACC 15578 KACC 14198 KACC 14199 KACC 15579 KACC 15341 KACC 14087 KCTC3841 KACC 14476 KACC 11491 KACC 14353 KACC 12302 KACC 12292 KACC 14352 KACC 15580 KACC 15581 KACC 13094 KACC 10734 KACC 10739 KACC 10735 LMG 1242 LMG 1794 LMG 2092

[12]b +d + + + + + + -

This studyc + + + + + -

KACC, Korean Agricultural Culture Collection, Republic of Korea (http://www.genebank.go.kr/); KCTC, Korean Collection for Type Cultures, Republic of Korea; LMG, The Belgian Co-ordinated Collections of Microorganisms (BCCMTM). a T: type strain. b Reference 12. c Membrane-fusion protein of Paenibacillus polymyxa E681. Positions Pp268F/R correspond to GenBank Accession No. ADM71678.1, gi:305859890, gb|CP000154.1:4232316-4233653. d +, detected; -, not detected.

QUANTITATIVE REAL-TIME PCR ASSAY FOR DETECTION

P. polymyxa and other bacterial genome sequences were obtained from the NCBI GenBank bacterial genome resource (ftp://ftp.ncbi.nlm.nih.gov/genbank/genomes/bacteria). A primer pair was designed for the membrane-fusion protein of P. polymyxa E681, with a predicted PCR product of 268 bp (Table 2). The combination of the primer pair sequences was blasted against GenBank (BLASTN 2.2.25+). The following culture media and incubation conditions were obtained from the Handbook of Microbiological Media [1]. The bacterial reference strains used in this study are listed in Table 1. The genomic DNA was extracted with the DNeasy Tissue kit (QIAGEN) according to the manufacturer’s recommendations. The PCR assay was performed using the GoTaq DNA polymerase (Promega) according to the manufacturer's instructions. The amplifications were performed using a PTC-225 thermocycler (MJ Research) with the following cycling conditions: initial denaturation of 5 min at 95oC; 35 cycles of 1 min at 95oC, 30 s at 63oC, and 1 min at 72oC; and a final extension of 7 min at 72oC. Each amplified PCR product was electrophoresed through a 1.5% agarose gel, stained with ethidium bromide, visualized on a UV transilluminator, and imaged using a gel imaging system. The SYBR Green qPCR assay was performed with a total of 20 µl containing the reagent mix and FastStart Universal SYBR Green Master (Roche Applied Science) according to the manufacturer’s instructions, and approximately 5 ng of purified DNA was used as template from each

1577

sample. The qPCR amplifications were performed using a CFX96 real-time PCR system (Bio-Rad Laboratories) and the cycling condition: of initial denaturation of 10 min at 95oC; 40 cycles of 15 s at 95oC, and 30 s at 63oC; and a melting curve ranging from 65oC to 95oC, with an increment of 0.5oC. Determination of the cycle threshold (Ct) and the data analysis were set automatically by the CFX Manager Software system (Version 1.6, Bio-Rad Laboratories). For the amplification of the 16S rRNA gene, the TaqMan probe, primers, and reaction conditions were as recommended by Timmusk et al. [12]. To confirm the specificity of the primer set, the conventional and qPCR assays were determined by amplifying genomic DNA targets from 35 Paenibacillus species and from strains of other bacterial species, 5 Rhizobium species, 2 Pseudomonas species, and E. coli. The PCR results are summarized in Table 1. Amplification of DNA was not detected in the other Paenibacillus species and reference microorganisms; only assays with P. polymyxa yielded amplified products with fluorescent intensity and a single amplified DNA fragment (Table 1 and Fig. 1). For the analysis of the limit of quantitation (LOQ) and the limit of detection (LOD), cloned DNA, genomic DNA, and a bacterial cell suspension of P. polymyxa were serially diluted 10-fold and tested with qPCR. The PCR fragment of 268 bp was ligated into the pGEM-T easy cloning vector by TA cloning (Promega). The copy number of the cloned DNA was calculated using the following equation

Table 2. Sequences of the primers and probes used in this study. Primer

Sequences (5'-3')

29PpF 179PpR 32TM1 probe Pp268F Pp268R

GAGCGGGGTTGATTAGAAGC CTTTCCTCCTTCTCCCATGC FAM-CTTCTAATCAACCTAGCGGCGGACGG-TAMRA GCCCGTTGCCCCCGTAGA TGGCGCGACTGCTGAGGAAC

Annealing Amplicon temp. (oC) size (bp) 60

150

63

268

Gene or position

Reference

16S rRNA

[12]

4232316-4233653a This study

Membrane-fusion protein of Paenibacillus polymyxa E681. Positions Pp268F/R correspond to GenBank Accession No. ADM71678.1, gi:305859890, gb|CP000154.1, region: “4232316-4233653”.

a

Fig. 1. Specific PCR amplification of a membrane-fusion protein fragment from Paenibacillus polymyxa with the primer set Pp268F/R. Lane M, size marker (1 kb DNA plus ladder; Gibco BRL); lanes 1-47 are listed in Table 1. Lane 48 is distilled water.

1578

Cho et al.

[13]: copies/µl = [6.022 × 1023 (copies/mol) × amount (g)]/ [length (bp) × 660 (g/mol/bp)]. All reactions were performed in triplicate. To evaluate the efficiency of the qPCR amplification of P. polymyxa, a standard curve was generated by plotting the mean Ct (n = 3) versus the logarithmic concentration of

cloned DNA, genomic DNA, and the bacterial cell suspension (Table 3). The LOQ showed a good linear response and a high correlation coefficient (cloned DNA, R2 = 0.998, slope = -3.327, PCR efficiency = 99.8%, y-int. = 34.699), with a linear response in the concentration range of cloned and genomic DNA of 5 ng to 5 pg and 1.2

Table 3. Mean Ct end-point fluorescence of 10-fold serial dilutions of the Paenibacillus polymyxa cloned DNA, genomic DNA, and bacterial cell suspension as determined by the SYBR Green real-time PCR assay. Cloned DNA

a

Genomic DNA a

Bacterial cell

Plasmid copies/µl

Ct values

Weight/µl

Ct values

CFU/ml

Ct values

1.41 × 109 1.41 × 108 1.41 × 107 1.41 × 106 1.41 × 105 1.41 × 104 1.41 × 103

14.71 ± 0.09 18.10 ± 0.05 21.22 ± 0.24 24.89 ± 0.06 28.08 ± 0.04 31.47 ± 0.46 34.56 ± 0.90

5 ng 500 pg 50 pg 5 pg 500 fg 50 fg 5 fg

17.15 ± 0.20 20.42 ± 0.10 23.87 ± 0.20 27.46 ± 0.12 30.84 ± 0.13 34.82 ± 1.73 35.45 ± 0.05

1.2 × 107 1.2 × 106 1.2 × 105 1.2 × 104 1.2 × 103 1.2 × 102 1.2 × 101

16.14 ± 0.02 19.31 ± 0.07 22.76 ± 0.09 26.26 ± 0.07 29.35 ± 0.14 33.09 ± 0.28 36.18 ± 0.39

The threshold cycle.

Fig. 2. Specificity, melting peak, and standard curve of the Pp268F/R primer set using SYBR Green real-time PCR. (A) Fluorescent intensity as a function of concentration of template. For each assay, a series of 10-fold dilutions of cloned DNA (range, 1.41 × 109 to 1.41 × 103 copies/µl) was used as the template for PCR (1-7, sample dilutions). (B) Standard curve derived from the amplification plot. (C) Melting-curve analysis (1-7, sample dilutions; 8, no template control). (D) Melting-peak analysis (1-7, sample dilutions; 8, no template control). The negative first derivative of relative fluorescence units (–d(RFU)/dT) is plotted as a function of temperature. Amplified product, 78.50oC. The high peak indicates amplified product; the low peak is the no template control.

QUANTITATIVE REAL-TIME PCR ASSAY FOR DETECTION

× 107 to 1.2 × 101 colony forming units per ml (CFU/ml) of bacterial cell suspension (Table 3). The LOD was performed with 10-fold serial dilutions of both the genomic DNA and the bacterial cell suspension of P. polymyxa. The LOD of the genomic DNA and the bacterial cell suspension by SYBR Green qPCR assay were 5 × 100 fg/µl and 1.2 × 101 CFU/ml, respectively. The melting curve derived from the amplification plot is shown in Fig. 2C, and the analysis of the melting temperature and melting peaks of P. polymyxa with SYBR Green qPCR revealed a reproducible melting temperature of 78.50oC and specific peaks (Fig. 2D). In this study, we report that the qPCR-based method for detection of P. polymyxa is rapid and sensitive and can be used as an alternative method for agricultural soil monitoring.

Acknowledgment This work was supported by a grant from the NextGeneration BioGreen 21 Program (No.PJ008055), Rural Development Administration, Republic of Korea.

5.

6.

7.

8.

9.

10.

11.

REFERENCES 1. Atlas, R. M. 2004. Handbook of Microbiological Media, 3rd Ed. CRC Press. 2. Alvarez, V. M., I. von der Weid, L. Seldin, and A. L. Santos. 2006. Influence of growth conditions on the production of extracellular proteolytic enzymes in Paenibacillus peoriae NRRL BD-62 and Paenibacillus polymyxa SCE2. Lett. Appl. Microbiol. 43: 625-630. 3. Boonen, M., J. Mertens, J. Michiels, and E. Smolders. 2010. Quantitative PCR assays to enumerate Rhizobium leguminosarum strains in soil also target non viable cells and overestimate those detected by the plant infection method. Soil Biol. Biochem. 42: 2342-2344. 4. Budi, S. W., D. van Tuinen, C. Arnould, E. Dumas-Gaudot, V. Gianinazzi-Pearson, and S. Gianinazzi. 2000. Hydrolytic enzyme

12.

13.

14.

1579

activity of Paenibacillus sp. strain B2 and effect of antagonistic bacterium on cell wall integrity of two soil-borne pathogenic fungi. Appl. Soil Ecol. 15: 191-199. Haggag, W. and S. Timmusk. 2007. Colonization of peanut roots by biofilm forming Paenibacillus polymyxa initiates biocontrol against crown rot disease. J. Appl. Microbiol. 104: 961-969. He, Z., D. Kisla, L. Zhang, C. Yuan, K. B. Green-Church, and A. E. Yousef. 2007. Isolation and identification of a Paenibacillus polymyxa strain that coproduces a novel lantibiotic and polymyxin. Appl. Environ. Microbiol. 73: 168-178. Lal, S. and S. Tabacchioni. 2009. Ecology and biotechnological potential of Paenibacillus polymyxa: A minireview. Indian J. Microbiol. 49: 2-10. Macdonald, C. A., L. M. Clark, P. R. Hirsch, F. J. Zhao, and S. P. McGrath. 2011. Development of a real-time PCR assay for detection and quantification of Rhizobium leguminosarum bacteria and discrimination between different biovars in zinccontaminated soil. Appl. Environ. Microbiol. 77: 4626-4633. Silhavy, T. J., D. Kahne, and S. Walker. 2010. The Bacterial Cell Envelope. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY Timmusk, S., B. Nicander, U. Granhall, and E. Tillberg. 1999. Cytokinin production by Paenibacillus polymyxa. Soil Biol. Biochem. 31: 1847-1852. Timmusk, S. and E. G. Wagner. 1999. The plant-growth-promoting rhizobacterium Paenibacillus polymyxa induces changes in Arabidopsis thaliana gene expression: A possible connection between biotic and abiotic stress responses. Mol. Plant Microbe Interact. 12: 951-959. Timmusk, S., V. Paalme, U. Lagercrantz, and E. Nevo. 2009. Detection and quantification of Paenibacillus polymyxa in the rhizosphere of wild barley (Hordeum spontaneum) with realtime PCR. J. Appl. Microbiol. 107: 736-745. Whelan, J. A., N. B. Russel, and M. A. Whelan. 2003. A method for the absolute quantification of cDNA using real-time PCR. J. Immunol. Methods 278: 261-269. Zgurskaya, H. I., Y. Yamada, E. B. Tikhonova, Q. Ge, and G. Krishnamoorthy. 2009. Structural and functional diversity of bacterial membrane fusion proteins. Biochim. Biophys. Acta 1794: 794-807.